Stem-loop sequence mtr-MIR482

AccessionMI0018337 (change log)
DescriptionMedicago truncatula miR482 stem-loop
Gene family MIPF0000403; MIR482
Literature search

3 open access papers mention mtr-MIR482
(13 sentences)

Stem-loop
   ---         a           -ua     ---         --    -c   a 
5'    ggggaaggc uaggcauggga   guagg   gaagaagug  auaa  agc u
      ||||||||| |||||||||||   |||||   |||||||||  ||||  |||  
3'    ucccuuuug auccguacccu   caucc   cuucuucgu  uauu  ucg a
   auc         c           cca     auu         gg    au   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC235678.1: 65790-65893 [+]
intergenic
contig_59568: 419-522 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR482
mtr-MIR482AC235678.1: 65790-65893 [+]
mtr-MIR2118AC235678.1: 74374-74532 [-]
Database links

Mature sequence mtr-miR482-5p

Accession MIMAT0021232
Sequence

13 - 

ggcaugggauaguagggaaga

 - 33

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence mtr-miR482-3p

Accession MIMAT0027102
Sequence

69 - 

cuuaccuacaccucccaugcc

 - 89

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).