Stem-loop sequence mtr-MIR2111f

AccessionMI0018360 (change log)
DescriptionMedicago truncatula miR2111f stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111f
(8 sentences)

Stem-loop
         u             uc ug          -    --a  u gu  a    cuu 
5' uaagga aggguaaucugca  c  agguuuagaa caau   gu g  ua uuuc   a
   |||||| |||||||||||||  |  |||||||||| ||||   || |  || ||||    
3' auuccu uucuauuagacgu  g  uccgaaucuu guua   cg c  au aaag   a
         u             ga gu          u    aug  - ug  a    aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 16671474-16671589 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2111f
mtr-MIR2111echr7: 16678770-16678875 [-]
mtr-MIR2111fchr7: 16671474-16671589 [-]
Database links

Mature sequence mtr-miR2111f

Accession MIMAT0021256
Sequence

12 - 

uaaucugcauccugagguuua

 - 32

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2