![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sly-MIR482a |
|||||
Accession | MI0018482 (change log) | ||||
Previous IDs | sly-MIR482 | ||||
Description | Solanum lycopersicum miR482a stem-loop | ||||
Gene family | MIPF0000403; MIR482 | ||||
Literature search |
![]()
22 open access papers mention sly-MIR482a | ||||
Stem-loop |
u u - uu uuuuuc 5' cgaaaa cuauggggau ggug aguuggaaagcu uc u |||||| |||||||||| |||| |||||||||||| || u 3' gcuuuu gguauccuua ccac uuaaccuuucga ag c u c c uu uguucu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sly-miR482a |
|
Accession | MIMAT0020769 |
Previous IDs | sly-miR482 |
Sequence |
61 - uuuccaauuccacccauuccua - 82 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:21443685
"Profiling of short RNAs during fleshy fruit development reveals stage-specific sRNAome expression patterns"
Plant J. 67:232-246(2011).
|
2 |
PMID:22307647
"MicroRNA regulation of plant innate immune receptors"
Proc Natl Acad Sci U S A. 109:1790-1795(2012).
|