Stem-loop sequence isc-mir-5311

AccessionMI0018491 (change log)
DescriptionIxodes scapularis miR-5311 stem-loop
Stem-loop
   guuc      g c  ac         gg    g          u    cc  c  cg 
5'     cucugc g ag  guggugccc  gauu caguccaagc gcgg  gc cc  g
       |||||| | ||  |||||||||  |||| |||||||||| ||||  || ||   
3'     gagacg c uc  caccacggg  cuag gucagguucg cgcc  cg gg  c
   ----      g u  gc         ag    g          c    --  a  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS708614: 70265-70374 [-]
intergenic
Database links

Mature sequence isc-miR-5311

Accession MIMAT0021382
Sequence

64 - 

agcccgccgcuuggacugggau

 - 85

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).