Stem-loop sequence isc-mir-5313

AccessionMI0018493 (change log)
DescriptionIxodes scapularis miR-5313 stem-loop
Stem-loop
   aaacacacuuuucgucgaug      uuu    -    -   -  --   uccc  uc     ag 
5'                     uugaau   cugc cggc ggc ac  guu    gu  ucgag  c
                       ||||||   |||| |||| ||| ||  |||    ||  |||||   
3'                     gacuua   gaug gccg ccg ug  caa    ca  aguuc  a
   ----------------caug      -uc    u    a   a  uu   uuuc  cu     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS968311: 1340-1449 [-]
intergenic
Database links

Mature sequence isc-miR-5313

Accession MIMAT0021384
Sequence

81 - 

uuguagccagccguguagcuauucagg

 - 107

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).