Stem-loop sequence rmi-mir-5317b

AccessionMI0018500 (change log)
DescriptionRhipicephalus microplus miR-5317b stem-loop
Stem-loop
   ---a      u            c                              aag   aa 
5'     uuguua agcgcaagauca aacgacgacaaagggacaagaagaagauga   gcg  g
       |||||| |||||||||||| ||||||||||||||||||||||||||||||   |||   
3'     aacaau ucguguucuagu uugcugcuguuucccuguucuuuuucuacu   cgc  u
   ugcc      c            c                              ---   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5317b

Accession MIMAT0021391
Sequence

76 - 

ucuugucccuuugucgucguucu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).