Stem-loop sequence rmi-mir-5319

AccessionMI0018501 (change log)
DescriptionRhipicephalus microplus miR-5319 stem-loop
Stem-loop
   cac          cu     ------       ug          a a     gua  u 
5'    cuacuugcag  gcaga      aagcagu  uuuugggagg c cugcu   ug u
      ||||||||||  |||||      |||||||  |||||||||| | |||||   || a
3'    ggugagcguc  cgucu      uucguca  aagaccuuuc g gacga   ac g
   --u          --     gagcuu       gu          c -     aca  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5319

Accession MIMAT0021392
Sequence

65 - 

caggccuuuccagaaugacugc

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).