Stem-loop sequence rmi-mir-5320

AccessionMI0018502 (change log)
DescriptionRhipicephalus microplus miR-5320 stem-loop
Stem-loop
   guuuuuuagucgcugccauauauagcgacacaaagaauuuaauug  gua     u       caa     ---u    aaa 
5'                                              ag   uauga aagacgg   uucca    gacu   g
                                                ||   ||||| |||||||   |||||    ||||   g
3'                                              uc   augcu uuuugcu   aaggu    uugg   u
   ---------------------------acgauaggaaaggccaaa  aaa     -       agg     ccuu    gcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5320

Accession MIMAT0021393
Sequence

94 - 

uggaaggaucguuuuucg

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).