Stem-loop sequence rmi-mir-5321

AccessionMI0018503 (change log)
DescriptionRhipicephalus microplus miR-5321 stem-loop
Stem-loop
   uuccc    ---a  g     -ua  aa   u   a    guggug  --   uc 
5'      guuu    ga gauau   gc  cca gaa gugu      cc  gga  a
        ||||    || |||||   ||  ||| ||| ||||      ||  |||   
3'      caaa    cu cuaug   cg  ggu cuu uacg      gg  ucu  a
   -uucu    ccac  g     uga  cg   u   a    -aaaaa  ua   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5321

Accession MIMAT0021394
Sequence

56 - 

uauggaaaaagcauauucuugggcgc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).