Stem-loop sequence rmi-mir-5322

AccessionMI0018504 (change log)
DescriptionRhipicephalus microplus miR-5322 stem-loop
Stem-loop
   ucauuugccacuuaaggcacca       aua    caagau   ccugc      ---     a 
5'                       uugauga   cgug      cag     aauuca   aggac u
                         |||||||   ||||      |||     ||||||   ||||| c
3'                       gacuacu   gcau      guc     uuaagu   ucuug a
   -------------ccgagaaac       aac    -cagau   --uuu      cuu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5322

Accession MIMAT0021395
Sequence

82 - 

uucuguagacuacgcaaucaucagcaa

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).