Stem-loop sequence rmi-mir-5323

AccessionMI0018505 (change log)
DescriptionRhipicephalus microplus miR-5323 stem-loop
Stem-loop
   ca g   -  gag      a      ----a -       acga g     a    g   u 
5'   c gcc cc   uugcau gguggc     g cagggag    u acguc ccca aug g
     | ||| ||   |||||| ||||||     | |||||||    | ||||| |||| ||| g
3'   g cgg gg   aacgug ucgcug     c guuucuc    g uguag gggu ugc c
   -g g   c  --g      g      auagg a       ---- g     c    g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5323

Accession MIMAT0021396
Sequence

69 - 

gauguggcucuuugacggauag

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).