Stem-loop sequence rmi-mir-5324

AccessionMI0018506 (change log)
DescriptionRhipicephalus microplus miR-5324 stem-loop
Stem-loop
   -----       -  ugc      --gcgc        -cauc  c   -     c    g 
5'      gcgcgcg ca   gcuguc      uucgagaa     gg agc ugacg gcgc c
        ||||||| ||   ||||||      ||||||||     || ||| ||||| ||||  
3'      cgcgcgc gu   cgacag      aagcucuu     cc ucg guugc cgcg a
   acgua       a  ---      acuuac        ccccc  u   c     -    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5324

Accession MIMAT0021397
Sequence

23 - 

uucgagaacaucggcagcugacgc

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).