Stem-loop sequence rmi-mir-5325

AccessionMI0018507 (change log)
DescriptionRhipicephalus microplus miR-5325 stem-loop
Stem-loop
   -----    u            -               a               aga 
5'      aaaa uugauuugcugc caagcuugaaggaaa caagggagacaggaa   g
        |||| |||||||||||| ||||||||||||||| |||||||||||||||   c
3'      uuuu aacuaaacgacg guucgaacuuccuuu guucccucuguccuu   g
   augga    u            u               -               gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5325

Accession MIMAT0021398
Sequence

23 - 

uugaaggaaaacaagggagacaggaa

 - 48

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).