Stem-loop sequence rmi-mir-5326

AccessionMI0018508 (change log)
DescriptionRhipicephalus microplus miR-5326 stem-loop
Stem-loop
   g  aua  -c     -----     aac g    --   -     a         agaa     ag 
5'  gu   ac  cuguc     guggg   u guuu  uug ugagc cuguucgga    cuuca  a
    ||   ||  |||||     |||||   | ||||  ||| ||||| |||||||||    |||||  a
3'  ca   ug  gacag     cgccu   a uaaa  aac auucg gacaaguuu    ggggu  a
   a  --g  uc     aguuu     aac g    ca   g     -         -acg     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5326

Accession MIMAT0021399
Sequence

72 - 

uugaacaggcuuagcaaacaaaugaca

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).