Stem-loop sequence rmi-mir-5327

AccessionMI0018509 (change log)
DescriptionRhipicephalus microplus miR-5327 stem-loop
Stem-loop
   --gagcgucauaaaaa       gaaa      --     g    c    aaa  agaa 
5'                 acgaauu    ugguuc  gugag cugc aaaa   ca    c
                   |||||||    ||||||  ||||| |||| ||||   ||    g
3'                 ugcuuaa    accagg  cauuc gacg uuuu   gu    a
   cgaauuuugaacuaua       --aa      aa     a    a    agg  aaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5327

Accession MIMAT0021400
Sequence

23 - 

aaaugguucgugaggcugcc

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).