Stem-loop sequence rmi-mir-5328

AccessionMI0018510 (change log)
DescriptionRhipicephalus microplus miR-5328 stem-loop
Stem-loop 
   caaa ag   u   -aa    a   uaga g   c -         u g    gg   c 
5'     g  ugc gug   gccg guu    g agu g aagcagcgu g ccug  acg c
       |  ||| |||   |||| |||    | ||| | ||||||||| | ||||  |||  
3'     c  acg uac   cggc cag    c ucg c uucguugcg c ggac  ugc g
   ---g gg   c   gug    g   ---- g   a g         - g    uu   g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5328

Accession MIMAT0021401
Sequence

24 -  

uuagaggagucgaagcagcguuggcc

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).