Stem-loop sequence rmi-mir-5332

AccessionMI0018514 (change log)
DescriptionRhipicephalus microplus miR-5332 stem-loop
Stem-loop
   gggcaauaucaggccuucg   uc     -guc    u  a    u   a  -cuucg   auc 
5'                    gac  guccu    ggcg ca gucg agc gc      gcc   c
                      |||  |||||    |||| || |||| ||| ||      |||    
3'                    uug  cggga    ucgc gu cagu ucg cg      cgg   a
   ---------------cgaa   uu     aguu    -  a    -   -  auaaug   cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5332

Accession MIMAT0021405
Sequence

23 - 

ucguccugucggcgucaagucguagca

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).