Stem-loop sequence rmi-mir-5333

AccessionMI0018515 (change log)
DescriptionRhipicephalus microplus miR-5333 stem-loop
Stem-loop
   gcacgaguuacuu        g    -gaugu      auuaca      cu   g ug g  u 
5'              cugcguuu accg      guugug      gcagcu  uuc g  c ug a
                |||||||| ||||      ||||||      ||||||  ||| |  | ||  
3'              gacgcgaa uggc      uaacgu      ugucga  aag c  g ac a
   ----------agc        g    augugg      -gacgg      --   g gu -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5333

Accession MIMAT0021406
Sequence

34 - 

ugugauuacagcagcucuuucggu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).