Stem-loop sequence rmi-mir-5335

AccessionMI0018517 (change log)
DescriptionRhipicephalus microplus miR-5335 stem-loop
Stem-loop
       u  g     -gg   - -  uu   u    uuu        g   cu a 
5' ccuc gc uacau   ugg c ug  ucg uggg   uugugcgc agc  c a
   |||| || |||||   ||| | ||  ||| ||||   |||||||| |||  | u
3' ggag cg gugua   acu g gc  ggc gccc   agcgcgug ucg  g c
       -  -     aaa   u u  cu   u    --u        -   uu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5335

Accession MIMAT0021408
Sequence

56 - 

uugcugugcgcgaucccgucgguc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).