miRBase entry: rmi-mir-5336

Stem-loop rmi-mir-5336


Accession
MI0018518
Description
Rhipicephalus microplus rmi-mir-5336 precursor miRNA

Literature search
1 open access papers mention rmi-mir-5336
(1 sentences)

Sequence


ucacgucUUUGAUCUCAUUCGGCGCGGUUUCCUCgagaagcacagaaagaacuugccuguugaggagucgcaaguuagaugcagggucuucgggcauaaacagcauggugugcggccaccgcuguggugca
...((.....(((((((((.((((((..((((((((.(.(((.((......))))).).)))))))).)))..))).))))..)))))..)).((((..(((((..((((......))))))))).)))).

Structure
------------------------------------uca  ucUUU     --    C   --   GU        g a   c  aa 
                                       cg     GAUCU  CAUU GGC  GCG  UUCCUCga a gca ag  a
                                       ||     |||||  |||| |||  |||  |||||||| | ||| ||   
                                       gc     cuggg  guag uug  cgc  gaggaguu u cgu uc  g
acguggugucgccaccggcgugugguacgacaaauacgg  ---uu     ac    a   aa   -u        g c   -  aa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature rmi-miR-5336

Accession MIMAT0021409
Description Rhipicephalus microplus rmi-miR-5336 mature miRNA
Sequence 8 - UUUGAUCUCAUUCGGCGCGGUUUCCUC - 34
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 21699734
    Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus
    Barrero RA, Keeble-Gagnère G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M
    BMC Genomics (2011) 12:328