Stem-loop sequence asu-let-7

AccessionMI0018525 (change log)
DescriptionAscaris suum let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention asu-let-7
(7 sentences)

Stem-loop
   -     u  uu   g          u      --g    cug 
5'  ucugc cg  gag uaguagguug auaguu   cgag   c
    ||||| ||  ||| |||||||||| ||||||   ||||   a
3'  aggcg gc  uuc aucguccgac ugucaa   gcuu   u
   c     c  cg   g          c      aga    ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-let-7-5p

Accession MIMAT0021417
Previous IDsasu-let-7
Sequence

10 - 

ugagguaguagguuguauaguu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-let-7-3p

Accession MIMAT0021418
Previous IDsasu-let-7*
Sequence

55 - 

cuguccagccugcuagcuugcc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).