Stem-loop sequence gma-MIR5368

AccessionMI0018621 (change log)
DescriptionGlycine max miR5368 stem-loop
Literature search

1 open access papers mention gma-MIR5368
(1 sentences)

Stem-loop
          -          g    g     -----     -    gcuuagguggagggcaaagaagacuuccuucugagggggccag 
5' acuguuu ccugggauug cuuu ggcuu     uccug caca                                           a
   ||||||| |||||||||| |||| |||||     ||||| ||||                                            
3' ugacaga ggacucugac ggga ccggg     aggac gugu                                           g
          u          a    g     uaucc     c    uccaaucuuaagaucgagcaggucucaccauagagagacuacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 23728083-23728251 [+]
intergenic
Database links

Mature sequence gma-miR5368

Accession MIMAT0021602
Sequence

149 - 

ggacagucucagguagaca

 - 167

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).