Stem-loop sequence gma-MIR5037b

AccessionMI0018624 (change log)
DescriptionGlycine max miR5037b stem-loop
Gene family MIPF0001288; MIR5037
Literature search

1 open access papers mention gma-MIR5037b
(3 sentences)

Stem-loop
       -           --      u      cau    cgg  a       u 
5' cagu aacccucaaag  gcuucc agacuc   guua   uc aaucaau a
   |||| |||||||||||  |||||| ||||||   ||||   || ||||||| a
3' guca uuggggguuuc  ugaagg uuugag   uaau   gg uuaguug u
       a           aa      c      aau    -aa  a       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 57328532-57328634 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR5037b
gma-MIR862achr18: 57326469-57326558 [-]
gma-MIR5037bchr18: 57328532-57328634 [+]
Database links

Mature sequence gma-miR5037b

Accession MIMAT0021605
Sequence

5 - 

aacccucaaaggcuuccuag

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).