Stem-loop sequence gma-MIR5371

AccessionMI0018627 (change log)
DescriptionGlycine max miR5371 stem-loop
Literature search

1 open access papers mention gma-MIR5371
(1 sentences)

Stem-loop
         c                                c          c      guucuuucauugagauccaugguugagucuacucguuccaagccuaauaugga 
5' gggagg cccuaguccucgaauucuaggaauuagucacu agauccuaac ucuuug                                                     c
   |||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||                                                     u
3' cccucc gggaucaggaguuuaagaucuuuaaucaguga ucuaggauug agaaac                                                     g
         a                                c          u      gucgcuacuccaacucaacuaaccuccauucaaagcgcuaccggagaagcuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 34072242-34072464 [+]
intergenic
Database links

Mature sequence gma-miR5371-5p

Accession MIMAT0021608
Sequence

25 - 

uaggaauuagucacucagauc

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR5371-3p

Accession MIMAT0021609
Sequence

181 - 

ucucagugacuaauuucuaga

 - 201

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).