Stem-loop sequence gma-MIR5372

AccessionMI0018628 (change log)
DescriptionGlycine max miR5372 stem-loop
Literature search

2 open access papers mention gma-MIR5372
(5 sentences)

Stem-loop
   -       -     u      aac       au 
5'  uugcaug guugu cgauaa   uguugug  a
    ||||||| ||||| ||||||   |||||||   
3'  aacguau cgaua gcuauu   acaacau  a
   a       u     -      aac       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 5771324-5771388 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR5372
gma-MIR5372chr16: 5771324-5771388 [-]
gma-MIR4409chr16: 5771195-5771255 [-]
Database links

Mature sequence gma-miR5372

Accession MIMAT0021610
Sequence

9 - 

uuguucgauaaaacuguugug

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).