Stem-loop sequence gma-MIR403a

AccessionMI0018631 (change log)
DescriptionGlycine max miR403a stem-loop
Gene family MIPF0000290; MIR403
Literature search

5 open access papers mention gma-MIR403a
(18 sentences)

Stem-loop
       u       c                --a    uucucguu 
5' aaau gcagguu gugcgugaaucuaacg   aagu        c
   |||| ||||||| ||||||||||||||||   ||||        u
3' uuua uguucaa cacgcacuuagauugc   uuca        c
       c       a                guc    ccuuaccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 1041992-1042080 [+]
intergenic
Database links

Mature sequence gma-miR403a

Accession MIMAT0021613
Sequence

63 - 

uuagauucacgcacaaacuug

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).