Stem-loop sequence gma-MIR5376

AccessionMI0018635 (change log)
DescriptionGlycine max miR5376 stem-loop
Gene family MIPF0001304; MIR4998
Literature search

1 open access papers mention gma-MIR5376
(1 sentences)

Stem-loop
   u                          a -  c   a                                  a    aucuuca 
5'  gaagauuugaagaauuugggagaagg c gc guc aggucgaggguuucgugacuacagcuucugaagc cguc       c
    |||||||||||||||||||||||||| | || ||| |||||||||||||||||||||||||||||||||| ||||        
3'  cuucuaaacuucuuaaacccucuucc g cg cag uccagcucucaaagcacugauguugaagacuuug gcag       a
   a                          c a  c   a                                  c    aauaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR5376

Accession MIMAT0021617
Sequence

1 - 

ugaagauuugaagaauuuggga

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).