Stem-loop sequence gma-MIR156o

AccessionMI0018656 (change log)
DescriptionGlycine max miR156o stem-loop
Gene family MIPF0000008; MIR156
Literature search

40 open access papers mention gma-MIR156o
(163 sentences)

Stem-loop 
   -            -   -          a       cu       a 
5'  aaauugacagaa gag agugagcaca agaggca  ugauaua a
    |||||||||||| ||| |||||||||| |||||||  |||||||  
3'  uuuggcugucuu cuc ucacucgugu uuuucgu  acuauau u
   u            u   a          g       -c       c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 37469976-37470065 [+]
intergenic
Database links

Mature sequence gma-miR156o

Accession MIMAT0021639
Sequence

4 -  

uugacagaagagagugagcac

 - 24

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).