![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR156o |
|||||
Accession | MI0018656 (change log) | ||||
Description | Glycine max miR156o stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
40 open access papers mention gma-MIR156o | ||||
Stem-loop |
- - - a cu a 5' aaauugacagaa gag agugagcaca agaggca ugauaua a |||||||||||| ||| |||||||||| ||||||| ||||||| 3' uuuggcugucuu cuc ucacucgugu uuuucgu acuauau u u u a g -c c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR156o |
|
Accession | MIMAT0021639 |
Sequence |
4 - uugacagaagagagugagcac - 24 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|