Stem-loop sequence gma-MIR169n

AccessionMI0018666 (change log)
DescriptionGlycine max miR169n stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169n
(97 sentences)

Stem-loop 
         c         u                cacu        c    uu    a 
5' ggagug agccaaggg gauuugccggcacagg    aauuaguu aaua  gaau g
   |||||| ||||||||| ||||||||||||||||    |||||||| ||||  |||| u
3' cuuuac ucgguucuc uugaacggccgugucu    uuaguuag uugu  cuug u
         a         u                ucau        u    --    a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 14166062-14166176 [+]
intergenic
Database links

Mature sequence gma-miR169n-5p

Accession MIMAT0021654
Previous IDsgma-miR169n
Sequence

7 -  

cagccaagggugauuugccgg

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR169n-3p

Accession MIMAT0032126
Sequence

87 -  

ugccggcaaguuucucuuggc

 - 107

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).