![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR169n |
|||||
Accession | MI0018666 (change log) | ||||
Description | Glycine max miR169n stem-loop | ||||
Gene family | MIPF0000037; MIR169_2 | ||||
Literature search |
![]()
23 open access papers mention gma-MIR169n | ||||
Stem-loop |
c u cacu c uu a 5' ggagug agccaaggg gauuugccggcacagg aauuaguu aaua gaau g |||||| ||||||||| |||||||||||||||| |||||||| |||| |||| u 3' cuuuac ucgguucuc uugaacggccgugucu uuaguuag uugu cuug u a u ucau u -- a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR169n-5p |
|
Accession | MIMAT0021654 |
Previous IDs | gma-miR169n |
Sequence |
7 - cagccaagggugauuugccgg - 27 |
Evidence | experimental; Illumina [1] |
Mature sequence gma-miR169n-3p |
|
Accession | MIMAT0032126 |
Sequence |
87 - ugccggcaaguuucucuuggc - 107 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|