Stem-loop sequence gma-MIR319g

AccessionMI0018672 (change log)
DescriptionGlycine max miR319g stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319g
(44 sentences)

Stem-loop
        -      u            c    c   uu      uauaau      uu     g ugaauuaacugauucauucauacaauaguauucaauua 
5' gggaa agagag gaaggaguuucc ucag cca  caugga      gaaaga  ggguu c                                      g
   ||||| |||||| |||||||||||| |||| |||  ||||||      ||||||  ||||| |                                      g
3' cccuu ucuuuu cuuccucgaggg aguc ggu  gugucu      cuuucu  cccaa g                                      g
        g      u            a    a   uc      ------      cc     g uuauaucuaugauaugagagaaguaaguguguuauaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 40809293-40809490 [+]
intergenic
Database links

Mature sequence gma-miR319g

Accession MIMAT0021661
Sequence

164 - 

uuggacugaagggagcuccuuc

 - 185

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).