Stem-loop sequence gma-MIR319i

AccessionMI0018674 (change log)
DescriptionGlycine max miR319i stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319i
(42 sentences)

Stem-loop
     g    u            -     c   c    gg uuc gg   uugaa   u   u   gc    g   ac          acacagaauagugauu 
5' aa agag gaaggagcuucc uucag cca gcau  g   g  gga     ggg ugc gaa  aucu cug  ucauucauac                c
   || |||| |||||||||||| ||||| ||| ||||  |   |  |||     ||| ||| |||  |||| |||  ||||||||||                 
3' uu ucuu cuuccucgaggg aaguc ggu cgug  u   c  ucu     ccc acg uuu  uaga gac  aguaagugug                a
     g    u            g     a   u    uu --- uu   -----   u   u   -a    g   ga          uuaauggaaucguuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 49476554-49476747 [+]
intergenic
Database links

Mature sequence gma-miR319i

Accession MIMAT0021663
Sequence

164 - 

uuggacugaaggggagcuccuuc

 - 186

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
2