Stem-loop sequence gma-MIR319k

AccessionMI0018676 (change log)
DescriptionGlycine max miR319k stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319k
(42 sentences)

Stem-loop
      uu   a                 cu  u   ug  u      uu     --  g  g   ac        u  aa        aauua    c 
5' agu  aag gagcuuccuucagucca  ca gga  gg agaggg  ugaau  ua cu cug  ucauucau ca  cacaauag     guau a
   |||  ||| |||||||||||||||||  || |||  || ||||||  |||||  || || |||  |||||||| ||  ||||||||     ||||  
3' uca  uuc cucgagggaagucaggu  gu ucu  uc uuuucc  acuug  au ga gac  aguaagug gu  guguuauc     uaug u
      uu   c                 uc  u   gu  -      -u     aa  g  g   gu        u  aa        ----g    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 28073920-28074105 [+]
intergenic
Database links

Mature sequence gma-miR319k

Accession MIMAT0021665
Sequence

160 - 

uuggacugaagggagcucccu

 - 180

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).