Stem-loop sequence gma-MIR319l

AccessionMI0018677 (change log)
DescriptionGlycine max miR319l stem-loop
Gene family MIPF0001104; MIR319
Literature search

18 open access papers mention gma-MIR319l
(43 sentences)

Stem-loop
   u     g  c    au            g   c        cccu       c 
5'  gaaag ug agaa  aggaguucccuu cag ccaaaaca    gcaugaa u
    ||||| || ||||  |||||||||||| ||| ||||||||    |||||||  
3'  cuuuc ac ucuu  uccucgagggaa guc gguuuugu    uguacuu a
   a     -  u    cu            -   a        ----       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 9165413-9165514 [-]
intergenic
Database links

Mature sequence gma-miR319l

Accession MIMAT0021666
Sequence

68 - 

uuggacugaagggagcuccuuc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).