Stem-loop sequence gma-MIR319m

AccessionMI0018678 (change log)
DescriptionGlycine max miR319m stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319m
(42 sentences)

Stem-loop
        uu   a                 cu      ug au      uu     --  g  g   ac       uu  aa        --a  g gu 
5' auagu  aag gagcuuccuucagucca  caugga  g  agaggg  ugaau  ua cu cug  ucauuca  ca  cacaauag   ac g  g
   |||||  ||| |||||||||||||||||  ||||||  |  ||||||  |||||  || || |||  |||||||  ||  ||||||||   || |   
3' uguca  uuc cucgagggaagucaggu  gugucu  u  uuuccu  acuug  au ga gac  aguaagu  gu  guguuauc   ug u  u
        uu   c                 uc      gu cu      --     aa  g  g   gu       cc  aa        gua  g ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 4298047-4298236 [-]
intergenic
Database links

Mature sequence gma-miR319m

Accession MIMAT0021667
Sequence

162 - 

uuggacugaagggagcucccu

 - 182

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).