Stem-loop sequence gma-MIR4413b

AccessionMI0018684 (change log)
DescriptionGlycine max miR4413b stem-loop
Literature search

7 open access papers mention gma-MIR4413b
(16 sentences)

Stem-loop
           a a            a  ---u    a 
5' caucaaua g gaauuguaaguc cu    gauu g
   |||||||| | |||||||||||| ||    ||||  
3' guaguuau c cuuaacauucag gg    uuaa g
           g -            a  cauu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 16661157-16661224 [-]
intergenic
Database links

Mature sequence gma-miR4413b

Accession MIMAT0021675
Sequence

7 - 

uaagagaauuguaagucacu

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).