Stem-loop sequence aca-let-7a

AccessionMI0018701 (change log)
DescriptionAnolis carolinensis let-7a stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7a
(1 sentences)

Stem-loop
   ----    -a  g     u   gu     gu         uuagggucauac 
5'     cugc  cu uggga gag  aguag  uguauaguu            c
       ||||  || ||||| |||  |||||  |||||||||            c
3'     gacg  ga auccu uuc  ucauc  acauaucaa            a
   aaaa    ga  a     -   ug     ug         uagagggucacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343225.1: 748885-748985 [-]
intergenic
Clustered miRNAs
< 10kb from aca-let-7a
aca-let-7aGL343225.1: 748885-748985 [-]
aca-let-7f-2GL343225.1: 748285-748391 [-]
aca-let-7dGL343225.1: 747541-747637 [-]
Database links

Mature sequence aca-let-7a-5p

Accession MIMAT0021692
Previous IDsaca-let-7a
Sequence

14 - 

ugagguaguagguuguauaguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7a-3p

Accession MIMAT0021693
Previous IDsaca-let-7a*
Sequence

65 - 

cuauacagucuacugucuuuc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).