Stem-loop sequence aca-let-7b

AccessionMI0018702 (change log)
DescriptionAnolis carolinensis let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7b
(2 sentences)

Stem-loop
   uagcucugg     u                     ucaggguagucauuu 
5'          caagg gagguaguagguugugugguu               u
            ||||| |||||||||||||||||||||                
3'          guucc uuccgucauccaacauaucaa               g
   --------a     -                     uagaggacuaacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 83532327-83532421 [-]
intergenic
Clustered miRNAs
< 10kb from aca-let-7b
aca-let-7a-3chr5: 83533339-83533414 [-]
aca-let-7bchr5: 83532327-83532421 [-]
Database links

Mature sequence aca-let-7b-5p

Accession MIMAT0021694
Previous IDsaca-let-7b
Sequence

15 - 

ugagguaguagguuguguggu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7b-3p

Accession MIMAT0021695
Previous IDsaca-let-7b*
Sequence

71 - 

cuauacaaccuacugccuucc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).