Stem-loop sequence aca-let-7c-1

AccessionMI0018703 (change log)
DescriptionAnolis carolinensis let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7c-1
(1 sentences)

Stem-loop
   ------      a      uu   g   u             ua  g ua a 
5'       gugugc uccggg  gag uag agguuguaugguu  ga u  c c
         |||||| ||||||  ||| ||| |||||||||||||  || |  | c
3'       cacacg agguuc  uuc auc uccaacaugucaa  uu a  g c
   caaguu      -      cu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 154032171-154032268 [-]
sense
ENSACAT00000019163 ; aca-let-7c-1-201; exon 1
Clustered miRNAs
< 10kb from aca-let-7c-1
aca-mir-99achr3: 154034468-154034536 [-]
aca-let-7c-1chr3: 154032171-154032268 [-]
Database links

Mature sequence aca-let-7c-5p

Accession MIMAT0021696
Previous IDsaca-let-7c
Sequence

15 - 

ugagguaguagguuguaugguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7c-1-3p

Accession MIMAT0021697
Previous IDsaca-let-7c-1*
Sequence

60 - 

cuguacaaccuucuagcuuucc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).