Stem-loop sequence aca-let-7c-2

AccessionMI0018704 (change log)
DescriptionAnolis carolinensis let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7c-2
(1 sentences)

Stem-loop
   cc     -      a uu   g   u             uagaauaaca 
5'   ggcgu gccucg g  gag uag agguuguaugguu          c
     ||||| |||||| |  ||| ||| |||||||||||||           
3'   ccgca cggggc c  uuc auc uccgacaugucaa          c
   ca     a      c cu   g   c             uagaggacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343604.1: 264152-264250 [+]
intergenic
Clustered miRNAs
< 10kb from aca-let-7c-2
aca-mir-99bGL343604.1: 262454-262523 [+]
aca-let-7c-2GL343604.1: 264152-264250 [+]
Database links

Mature sequence aca-let-7c-5p

Accession MIMAT0021696
Previous IDsaca-let-7c
Sequence

17 - 

ugagguaguagguuguaugguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7c-2-3p

Accession MIMAT0021698
Previous IDsaca-let-7c-2*
Sequence

63 - 

cuguacagccuccuagcuuucc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).