Stem-loop sequence aca-let-7c-2

Accession MI0018704
Description Anolis carolinensis let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cc     -      a uu   g   u             uagaauaaca 
  ggcgu gccucg g  gag uag agguuguaugguu          c
  ||||| |||||| |  ||| ||| |||||||||||||           
  ccgca cggggc c  uuc auc uccgacaugucaa          c
ca     a      c cu   g   c             uagaggacua 
Get sequence
Genome context
Coordinates (AnoCar2.0) Overlapping transcripts
GL343604.1: 264152-264250 [+]
intergenic
Clustered miRNAs
< 10kb from aca-let-7c-2
aca-mir-99b GL343604.1: 262454-262523 [+]
aca-let-7c-2 GL343604.1: 264152-264250 [+]

Mature sequence aca-let-7c-5p

Accession MIMAT0021696
Previous IDs aca-let-7c
Sequence

17 - 

ugagguaguagguuguaugguu

 - 38

Get sequence
Evidence experimental; Solexa [1]

Mature sequence aca-let-7c-2-3p

Accession MIMAT0021698
Previous IDs aca-let-7c-2*
Sequence

63 - 

cuguacagccuccuagcuuucc

 - 84

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).