Stem-loop sequence aca-let-7d

AccessionMI0018705 (change log)
DescriptionAnolis carolinensis let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7d
(1 sentences)

Stem-loop
   gug   u       a              c      -------uua      u 
5'    ggc ccuagga gagguaguagguug auaguu          gggcag g
      ||| ||||||| |||||||||||||| ||||||          |||||| g
3'    ucg ggauucu uuccgucguccaac uaucaa          cccguu u
   ---   -       -              a      uugaggaaaa      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343225.1: 747541-747637 [-]
sense
ENSACAT00000020806 ; aca-let-7d-201; exon 1
Clustered miRNAs
< 10kb from aca-let-7d
aca-let-7aGL343225.1: 748885-748985 [-]
aca-let-7f-2GL343225.1: 748285-748391 [-]
aca-let-7dGL343225.1: 747541-747637 [-]
Database links

Mature sequence aca-let-7d-5p

Accession MIMAT0021699
Previous IDsaca-let-7d
Sequence

15 - 

agagguaguagguugcauagu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7d-3p

Accession MIMAT0021700
Previous IDsaca-let-7d*
Sequence

69 - 

cuauacaaccugcugccuuuc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).