Stem-loop sequence aca-let-7f-1

AccessionMI0018707 (change log)
DescriptionAnolis carolinensis let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7f-1
(1 sentences)

Stem-loop
   ucc     u   gu               ----      gu au 
5'    uggga gag  aguagauuguauagu    uuuagg  c  a
      ||||| |||  |||||||||||||||    ||||||  |   
3'    auccu uuc  ucaucuaacauauca    agguuc  g  c
   -gu     -   ug               auag      ug cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 205026170-205026253 [-]
sense
ENSACAT00000020807 ; aca-let-7f-1-201; exon 1
ENSACAT00000004565 ; HUWE1-201; intron 58
Clustered miRNAs
< 10kb from aca-let-7f-1
aca-let-7f-1chr1: 205026170-205026253 [-]
aca-mir-98chr1: 205025683-205025789 [-]
Database links

Mature sequence aca-let-7f-5p

Accession MIMAT0021703
Previous IDsaca-let-7f
Sequence

9 - 

ugagguaguagauuguauaguu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7f-1-3p

Accession MIMAT0021704
Previous IDsaca-let-7f-1*
Sequence

59 - 

cuauacaaucuacugucuuu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).