Stem-loop sequence aca-let-7f-2

AccessionMI0018708 (change log)
DescriptionAnolis carolinensis let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7f-2
(1 sentences)

Stem-loop
   -----uu    uua     uu                       ---------       u 
5'        cucu   ucagg  gagguaguagauuguauaguugu         agggcag u
          ||||   |||||  |||||||||||||||||||||||         ||||||| a
3'        gagg   agucc  uuccguuaucuaacauaucaaua         ucccguu u
   uuacaau    ---     -c                       gaggacuuc       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343225.1: 748285-748391 [-]
sense
ENSACAT00000020669 ; aca-let-7f-2-201; exon 1
Clustered miRNAs
< 10kb from aca-let-7f-2
aca-let-7aGL343225.1: 748885-748985 [-]
aca-let-7f-2GL343225.1: 748285-748391 [-]
aca-let-7dGL343225.1: 747541-747637 [-]
Database links

Mature sequence aca-let-7f-5p

Accession MIMAT0021703
Previous IDsaca-let-7f
Sequence

16 - 

ugagguaguagauuguauaguu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7f-2-3p

Accession MIMAT0021705
Previous IDsaca-let-7f-2*
Sequence

72 - 

cuauacaaucuauugccuucc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).