Stem-loop sequence aca-let-7g

AccessionMI0018709 (change log)
DescriptionAnolis carolinensis let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7g
(1 sentences)

Stem-loop
   -uu  -   a        u        a            ugagg    -a  a    a 
5'    gc cug uuccgggu gagguagu guuuguacaguu     gucu  ug uacc c
      || ||| |||||||| |||||||| ||||||||||||     ||||  || ||||  
3'    cg gac gggguccg uuccguca cggacaugucaa     uaga  ac augg c
   uuu  a   -        -        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 153332754-153332862 [+]
sense
ENSACAT00000006657 ; WDR82-201; intron 2
Database links

Mature sequence aca-let-7g

Accession MIMAT0021706
Sequence

17 - 

ugagguaguaguuuguacaguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).