Stem-loop sequence aca-let-7i

AccessionMI0018710 (change log)
DescriptionAnolis carolinensis let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention aca-let-7i
(1 sentences)

Stem-loop
   -------g     cg  c     u                 u   --------  u     ugu 
5'         cacca  gc cuggc gagguaguaguuugugc guu        gg cgggu   g
           |||||  || ||||| ||||||||||||||||| |||        || |||||   a
3'         guggu  cg gaucg uuccgucaucgaacgcg caa        uc gcccg   c
   ggcuagua     --  u     -                 u   uagaggug  -     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 51075540-51075651 [-]
intergenic
Database links

Mature sequence aca-let-7i-5p

Accession MIMAT0021707
Previous IDsaca-let-7i
Sequence

17 - 

ugagguaguaguuugugcuguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-let-7i-3p

Accession MIMAT0021708
Previous IDsaca-let-7i*
Sequence

73 - 

cugcgcaagcuacugccuugcua

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).