Stem-loop sequence aca-mir-128-1

AccessionMI0018728 (change log)
DescriptionAnolis carolinensis miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   cagcaa  -      u             uua      aa    g gag 
5'       ug uacagu ggaaggggggccg   cacugu  gaga u   u
         || |||||| |||||||||||||   ||||||  |||| |    
3'       ac guguca ccuuuucucuggc   gugaca  cucu g   a
   -ucuac  u      u             caa      --    g acg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 42720735-42720830 [+]
sense
ENSACAT00000020734 ; aca-mir-128-1-201; exon 1
ENSACAT00000010265 ; ARPP21-201; intron 19
Database links

Mature sequence aca-miR-128-5p

Accession MIMAT0021732
Previous IDsaca-miR-128*
Sequence

21 - 

gggggccguuacacuguaaga

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-128-3p

Accession MIMAT0021733
Previous IDsaca-miR-128
Sequence

58 - 

ucacagugaaccggucucuuu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).