Stem-loop sequence osa-MIR5494

AccessionMI0019012 (change log)
DescriptionOryza sativa miR5494 stem-loop
Stem-loop
   a         --------     -g          c  ua  cacg   cu     uu   cuaa 
5'  uuuguuucu        uuaua  gagguauaga gg  gc    uca  uucuu  ugc    u
    |||||||||        |||||  |||||||||| ||  ||    |||  |||||  |||     
3'  gaacaaaga        aguau  uucuaugucu uc  cg    agu  aagag  acg    c
   a         uacgcuac     ag          c  cc  ---a   -c     -c   uacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 2317278-2317395 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5494
osa-MIR5494Chr1: 2317278-2317395 [-]
osa-MIR393aChr1: 2309149-2309263 [-]
Database links

Mature sequence osa-miR5494

Accession MIMAT0022127
Sequence

11 - 

uuauaggagguauagacggua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1