Stem-loop sequence cel-mir-5545

AccessionMI0019066 (change log)
DescriptionCaenorhabditis elegans miR-5545 stem-loop
Stem-loop
   -------    ag    g         c                 aa       gcau 
5'        ggug  gggu ugucccaug cgguuugaucuacaaaa  ugcggga    a
          ||||  |||| ||||||||| |||||||||||||||||  |||||||    g
3'        ucac  ucca acaggguac gccaaacuagauguuuu  acgcccu    a
   acuugug    ag    -         a                 -c       aaaa 
Get sequence
Deep sequencing
633 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 11885596-11885705 [+]
sense
Y47H9C.5b ; Y47H9C.5b; intron 1
Y47H9C.5a ; Y47H9C.5a; intron 6
Database links

Mature sequence cel-miR-5545-5p

Accession MIMAT0022181
Sequence

20 - 

gccgguuugaucuacaaaaaaugc

 - 43

Get sequence
Deep sequencing292 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-5545-3p

Accession MIMAT0022182
Sequence

65 - 

acuuuuguagaucaaaccgacau

 - 87

Get sequence
Deep sequencing315 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).