Stem-loop sequence cel-mir-5546

AccessionMI0019067 (change log)
DescriptionCaenorhabditis elegans miR-5546 stem-loop
Stem-loop
   ---a  uaaauaau   a            uuu   -       uu        aaac 
5'     gc        ugc uuuucgcaaccc   cgc caauuuu  ucgugaaa    g
       ||        ||| ||||||||||||   ||| |||||||  ||||||||     
3'     cg        acg aaaagcguuggg   gcg guuaaaa  agcauuuu    u
   ggca  --ccaauu   c            uac   c       --        aaug 
Get sequence
Deep sequencing
552 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 2888448-2888557 [-]
sense
Y71F9AL.16 ; Y71F9AL.16; intron 4
antisense
Y71F9AL.7 ; Y71F9AL.7; intron 1
Database links

Mature sequence cel-miR-5546-5p

Accession MIMAT0022183
Sequence

24 - 

acccuuucgccaauuuuuuucgu

 - 46

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-5546-3p

Accession MIMAT0022184
Sequence

67 - 

gaaaaauugcgcgcauggguug

 - 88

Get sequence
Deep sequencing522 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).