Stem-loop sequence cel-mir-5547

AccessionMI0019068 (change log)
DescriptionCaenorhabditis elegans miR-5547 stem-loop
Stem-loop
   cugcggaau                        a  a            aaaug 
5'          uuuguugauugagacaacuuuuag cc auaggcauccaa     a
            |||||||||||||||||||||||| || ||||||||||||      
3'          aagcaacuaacucuguugaaaauc gg uauccguagguu     u
   aaauagagu                        c  c            aaaac 
Get sequence
Deep sequencing
136 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 12238602-12238711 [+]
intergenic
Database links

Mature sequence cel-miR-5547-5p

Accession MIMAT0022185
Sequence

24 - 

caacuuuuagaccaauaggcau

 - 45

Get sequence
Deep sequencing97 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-5547-3p

Accession MIMAT0022186
Sequence

68 - 

gccuaucggccuaaaaguuguc

 - 89

Get sequence
Deep sequencing31 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).