Stem-loop sequence cel-mir-5548

AccessionMI0019069 (change log)
DescriptionCaenorhabditis elegans miR-5548 stem-loop
Stem-loop
   guuccauccuugaccgccgaacugguguuucauaaag       a uc       c   ag 
5'                                      ccuucuc c  uccacgg ggu  g
                                        ||||||| |  ||||||| |||   
3'                                      ggaagag g  agguguc ccg  c
   ------------aaagcccuguaggacaccccgaaga       - uu       -   aa 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 2284810-2284919 [-]
intergenic
Database links

Mature sequence cel-miR-5548-5p

Accession MIMAT0022187
Sequence

37 - 

gccuucucacucuccacggcgguagg

 - 62

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cel-miR-5548-3p

Accession MIMAT0022188
Sequence

65 - 

agcccuguggauuggagaaggaga

 - 88

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).